Top » Catalog » SNPs » FGC31333

$18.00

FGC31333
[FGC31333]

FGC31333
hg38 Position: ChrY:17232305..17232305
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC31333_F CCTGAGTCCTGCTACATCAGC
Reverse Primer: FGC31333_R AATCCAAGACCAAGGCACAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies