Top » Catalog » SNPs » FGC4441

$18.00

FGC4441
[FGC4441]

FGC4441
hg38 Position: ChrY:2910203..2910203
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC4441_F AGGGTTGATAGTAATGTCCCTTCTG
Reverse Primer: FGC4441_R CTGGTCTGTGTTTGTCCAGC
Reviews

Customers who bought this product also purchased
ZS8289
ZS8289
FGC60675
FGC60675
ZS1922
ZS1922
FGC59129
FGC59129
FGC57117
FGC57117
FGC4451
FGC4451
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies