Top » Catalog » SNPs » FGC7944

$19.00

FGC7944
[FGC7944]

FGC7944
hg38 Position: ChrY:12336010..12336010
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC1696
Forward Primer: FGC7944v21_F TGGTGAAACCCCATCTCTACC
Reverse Primer: FGC7944v21_R AGTACCTGAAGGCTTCTTCTGC
Reviews

Customers who bought this product also purchased
DYS388
DYS388
L859
L859
ZS8508
ZS8508
BY154453
BY154453
FGC4415
FGC4415
Y201633
Y201633
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies