Top » Catalog » SNPs » FGC7944

$18.00

FGC7944
[FGC7944]

FGC7944
hg38 Position: ChrY:12336010..12336010
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC1696
Forward Primer: FGC7944v21_F TGGTGAAACCCCATCTCTACC
Reverse Primer: FGC7944v21_R AGTACCTGAAGGCTTCTTCTGC
Reviews

Customers who bought this product also purchased
BY37630
BY37630
FGC16651
FGC16651
BY37632
BY37632
FGC11723
FGC11723
FGC58383
FGC58383
HU331
HU331
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies