Top » Catalog » SNPs » FGC7944

$18.00

FGC7944
[FGC7944]

FGC7944
hg38 Position: ChrY:12336010..12336010
Ancestral: C
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1a
Comments: Below FGC1696
Forward Primer: FGC7944v21_F TGGTGAAACCCCATCTCTACC
Reverse Primer: FGC7944v21_R AGTACCTGAAGGCTTCTTCTGC
Reviews

Customers who bought this product also purchased
FGC48131
FGC48131
ZS4756
ZS4756
FGC4309
FGC4309
Y183541
Y183541
ZS4753
ZS4753
Y170491
Y170491
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies