Top » Catalog » SNPs » Z2217

$18.00

Z2217
[Z2217]

Z2217
hg38 Position: ChrY:21079399..21079399
Ancestral: T
Derived: A
Reference: Bonnie Schrack (2012)
ISOGG Haplogroup: not listed
Comments: upstream of L136 and Z1834; downstream of M267
Forward Primer: Z2217_F ATATGGCCTGACCAAGCAAC
Reverse Primer: Z2217_R CAGGACCTTACCCACTTTCG
Reviews

Customers who bought this product also purchased
BY8
BY8
PF4881
PF4881
BY4
BY4
ZS2518
ZS2518
FGC4415
FGC4415
PF4845
PF4845
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies