Top » Catalog » SNPs » BY4

$19.00

BY4
[BY4]

BY4
hg38 Position: ChrY:22300121..22300121
Ancestral: G
Derived: A
Reference: FTDNA
ISOGG Haplogroup: J1 (not listed)
Comments: Below FGC12 > FGC1695
Forward Primer: BY4_F ATCTCTTATCTGGGTAAGGGTCAG
Reverse Primer: BY4_R CTTGTCTCGAACTCCTGACATG
Reviews

Customers who bought this product also purchased
FGC29864
FGC29864
Y134508
Y134508
ZS2022
ZS2022
ZS4227
ZS4227
J1-BY8 Panel
J1-BY8 Panel
GG315
GG315
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies