Top » Catalog » SNPs » FGC12393

$18.00

FGC12393
[FGC12393]

FGC12393
hg38 Position: ChrY:12385979..12385979
Ancestral: A
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b
Comments: Downstream Z142 > Z12222 > FGC12378 > FGC12383> FGC12401
Forward Primer: FGC12393_F CCATGCCCTCTTCTTATTGC
Reverse Primer: FGC12393_R AATTATCTATCTATGCTGTGTCTCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies