Top » Catalog » SNPs » YP198

$18.00

YP198
[YP198]

YP198
hg38 Position: ChrY:19588768..19588768
Ancestral: G
Derived: A
Reference: Francalacci (2013)
ISOGG Haplogroup: I2a
Comments: Aka S23503
Forward Primer: YP198_F AGACAAGGTCTTTCCCTGTCAC
Reverse Primer: YP198_R GGCTGAAATCAATCCAATCTG
Reviews

Customers who bought this product also purchased
S17250
S17250
FGC20473
FGC20473
CTS10228
CTS10228
A16633
A16633
L161.1
L161.1
FGC20479
FGC20479
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies