Top » Catalog » SNPs » YP198

$18.00

YP198
[YP198]

YP198
hg38 Position: ChrY:19588768..19588768
Ancestral: G
Derived: A
Reference: Francalacci (2013)
ISOGG Haplogroup: I2a
Comments: Aka S23503
Forward Primer: YP198_F AGACAAGGTCTTTCCCTGTCAC
Reverse Primer: YP198_R GGCTGAAATCAATCCAATCTG
Reviews

Customers who bought this product also purchased
I2a-M423 Panel
I2a-M423 Panel
F3145
F3145
S2679
S2679
S17250
S17250
FGC20473
FGC20473
CTS10228
CTS10228
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies