Top » Catalog » SNPs » A11428

$19.00

A11428
[A11428]

A11428
hg38 Position: ChrY:12355605..12355605
Ancestral: G
Derived: A
Reference: Janet Akaha (2016)
ISOGG Haplogroup: N and R1b
Comments: Observed below N-VL70 and R1b-FGC14600
Forward Primer: A11428_F AGAGCTGCTTGGTTTGCAG
Reverse Primer: A11428_R TCACTGCAAAGGACATCAAAAG
Reviews

Customers who bought this product also purchased
A11429
A11429
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11429
$19.00
Haplogroup Info
Other products
Currencies