Top » Catalog » SNPs » Y6209

$18.00

Y6209
[Y6209]

Y6209
hg38 Position: ChrY:19595654..19595654
Ancestral: A
Derived: G
Reference: YFull (2014)
ISOGG Haplogroup: I1a1b1 (not listed)
Comments: Downstream of P109 > S7660> S14887 > FGC14514
Forward Primer: Y6209_F CCAGGCATCAAGCACCTTAC
Reverse Primer: Y6209_R ATGTCCCACCCTATCAGACG
Reviews

Customers who bought this product also purchased
Y6207
Y6207
Y7092
Y7092
Y6206
Y6206
Y6212
Y6212
Y6205
Y6205
Y6211
Y6211
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies