Top » Catalog » SNPs » Y7092

$18.00

Y7092
[Y7092]

Y7092
hg38 Position: ChrY:2917346..2917346
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: Y7092_F CACAATATTGATTCTACCCATCCAG
Reverse Primer: Y7092_R TGCCTCCAGAATTTCAAACC
Reviews

Customers who bought this product also purchased
I1-Y3663 Bottleneck at FGC14500 Panel.
I1-Y3663 Bottleneck at FGC14500 Panel.
Y6209
Y6209
Y6208
Y6208
FGC14501
FGC14501
Y6207
Y6207
Y6212
Y6212
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies