Top » Catalog » SNPs » Y7092

$18.00

Y7092
[Y7092]

Y7092
hg38 Position: ChrY:2917346..2917346
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I1
Comments: .
Forward Primer: Y7092_F CACAATATTGATTCTACCCATCCAG
Reverse Primer: Y7092_R TGCCTCCAGAATTTCAAACC
Reviews

Customers who bought this product also purchased
Y6206
Y6206
Y6211
Y6211
Y6205
Y6205
Y6210
Y6210
I1-Y3663 Bottleneck at FGC14500 Panel.
I1-Y3663 Bottleneck at FGC14500 Panel.
Y6209
Y6209
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies