Top » Catalog » SNPs » A11477

$18.00

A11477
[A11477]

A11477
hg38 Position: ChrY:12021955..12021955
Ancestral: T
Derived: A
Reference: Joe Fox (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A11477_F TGGGGTTTCACCATATAGGCTAC
Reverse Primer: A11477_R GGACTTGTAAAAAATTGTAATCTATGCTC
Reviews

Customers who bought this product also purchased
A11479
A11479
A11478
A11478
A11475
A11475
A11480
A11480
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies