Top » Catalog » SNPs » PH908

$18.00

PH908
[PH908]

PH908
hg38 Position: ChrY:11986358..11986358
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PH908_F CTTATTCAGAAAGCCCAGTGC
Reverse Primer: PH908_R GAGCTGCACGATCAACCTC
Reviews

Customers who bought this product also purchased
A13910
A13910
BY55783
BY55783
FT190799
FT190799
B57
B57
Y161695
Y161695
Y25010
Y25010
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies