Top » Catalog » SNPs » PH908

$18.00

PH908
[PH908]

PH908
HG19 Position: ChrY:14107064..14107064
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: I2 (not listed)
Comments: Below S17250
Forward Primer: PH908_F CTTATTCAGAAAGCCCAGTGC
Reverse Primer: PH908_R GAGCTGCACGATCAACCTC
Reviews

Customers who bought this product also purchased
A815
A815
A5874
A5874
A5875
A5875
A16413
A16413
A1221
A1221
A356
A356
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies