Top » Catalog » SNPs » PH908

$17.50

PH908
[PH908]

PH908
HG19 Position: ChrY:14107064..14107064
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: I2 (not listed)
Comments: Below S17250
Forward Primer: PH908_F CTTATTCAGAAAGCCCAGTGC
Reverse Primer: PH908_R GAGCTGCACGATCAACCTC
Reviews

Customers who bought this product also purchased
Z16971
Z16971
A7318
A7318
Z16983
Z16983
A5913
A5913
Y3548
Y3548
I2a-M423 Panel
I2a-M423 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11001
1 x A11210
1 x A11125
1 x A10586
1 x A10745
1 x A113
1 x A10088
1 x A10229
$140.00
Haplogroup Info
Other products
Currencies