Top » Catalog » SNPs » PH908

$16.00

PH908
[PH908]

PH908
HG19 Position: ChrY:14107064..14107064
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: I2 (not listed)
Comments: Below S17250
Forward Primer: PH908_F CTTATTCAGAAAGCCCAGTGC
Reverse Primer: PH908_R GAGCTGCACGATCAACCTC
Reviews

Customers who bought this product also purchased
A13912
A13912
PH3310
PH3310
A356
A356
A7318
A7318
Z16971
Z16971
Z16983
Z16983
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies