Top » Catalog » SNPs » PH908

$18.00

PH908
[PH908]

PH908
hg38 Position: ChrY:11986358..11986358
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PH908_F CTTATTCAGAAAGCCCAGTGC
Reverse Primer: PH908_R GAGCTGCACGATCAACCTC
Reviews

Customers who bought this product also purchased
BY106777
BY106777
A13911
A13911
BY31898
BY31898
PLE04
PLE04
A20031
A20031
A21222
A21222
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies