Top » Catalog » SNPs » PH908

$18.00

PH908
[PH908]

PH908
hg38 Position: ChrY:11986358..11986358
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PH908_F CTTATTCAGAAAGCCCAGTGC
Reverse Primer: PH908_R GAGCTGCACGATCAACCTC
Reviews

Customers who bought this product also purchased
FT34788
FT34788
Y152112
Y152112
PF4609
PF4609
M284
M284
S31
S31
L145
L145
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies