Top » Catalog » SNPs » PH908

$18.00

PH908
[PH908]

PH908
hg38 Position: ChrY:11986358..11986358
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: PH908_F CTTATTCAGAAAGCCCAGTGC
Reverse Primer: PH908_R GAGCTGCACGATCAACCTC
Reviews

Customers who bought this product also purchased
FGC12095
FGC12095
A13910
A13910
FT65952
FT65952
FT190799
FT190799
A21278
A21278
Y39363
Y39363
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies