Top » Catalog » SNPs » A11535

$18.00

A11535
[A11535]

A11535
hg38 Position: ChrY:13051662..13051662
Ancestral: G
Derived: A
Reference: Wayne Kauffman (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below FGC564
Forward Primer: A11535v2_F CAAAATGATGATTGTCAGGGAC
Reverse Primer: A11535v2_R GATATTCAGTGTGCAATTCATTGG
Reviews

Customers who bought this product also purchased
DYS504
DYS504
DYS444
DYS444
DYS532
DYS532
DYS520
DYS520
DYS441
DYS441
DYS534
DYS534
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies