Top » Catalog » SNPs » FGC42781

$18.00

FGC42781
[FGC42781]

FGC42781
hg38 Position: ChrY:7066643..7066643
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: Downstream of FGC1695
Forward Primer: FGC42781v2_F GGCTCCACCTCTCAGGATTC
Reverse Primer: FGC42781v2_R TCAGCCCCCTGAGTACCTC
Reviews

Customers who bought this product also purchased
FT67308
FT67308
ZS10418
ZS10418
MF10702
MF10702
ZS10419
ZS10419
ZS5344
ZS5344
ZS10625
ZS10625
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies