Top » Catalog » SNPs » FGC42781

$18.00

FGC42781
[FGC42781]

FGC42781
hg38 Position: ChrY:7066643..7066643
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: Downstream of FGC1695
Forward Primer: FGC42781v2_F GGCTCCACCTCTCAGGATTC
Reverse Primer: FGC42781v2_R TCAGCCCCCTGAGTACCTC
Reviews

Customers who bought this product also purchased
FT63131
FT63131
FT160700
FT160700
Y113059
Y113059
ZS9500
ZS9500
FGC4711
FGC4711
M10667
M10667
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies