Top » Catalog » SNPs » A11532

$18.00

A11532
[A11532]

A11532
hg38 Position: ChrY:7689386..7689386
Ancestral: C
Derived: T
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: A11532_F AGGGATGCTCTGAATGATGTC
Reverse Primer: A11532_R GAGACAGGCAGTCTTGGAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies