Top » Catalog » SNPs » BY334

$18.00

BY334
[BY334]

BY334
hg38 Position: ChrY:16282686..16282686
Ancestral: C
Derived: G
Reference: FTDNA (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: BY334_F CCTTCTACTTAACAGTATTTTTGTACCG
Reverse Primer: BY334_R CTGCACCCCCTGCTTATG
Reviews

Customers who bought this product also purchased
YP314
YP314
YP1428
YP1428
Y5973.2
Y5973.2
YP1361
YP1361
Y4376
Y4376
YP1363
YP1363
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies