Top » Catalog » SNPs » BY334

$18.00

BY334
[BY334]

BY334
hg38 Position: ChrY:16282686..16282686
Ancestral: C
Derived: G
Reference: FTDNA (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: BY334_F CCTTCTACTTAACAGTATTTTTGTACCG
Reverse Primer: BY334_R CTGCACCCCCTGCTTATG
Reviews

Customers who bought this product also purchased
PH3519
PH3519
Y3219
Y3219
Y23598
Y23598
FGC10360
FGC10360
YP1144
YP1144
Y3222
Y3222
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies