Top » Catalog » SNPs » BZ113

$18.00

BZ113
[BZ113]

BZ113
hg38 Position: ChrY:17018371..17018371
Ancestral: A
Derived: G
Reference: Q Y-DNA Haplogroup project (2016)
ISOGG Haplogroup: Q1b
Comments: Below L245 > Y2209 > Y2225
Forward Primer: BZ113_F CTTATGTTAGCAAAAGCACTATGTATGTC
Reverse Primer: BZ113_R ATATACCACATTTTCCTCTTTCATTGAC
Reviews

Customers who bought this product also purchased
FGC10659
FGC10659
FGC10674
FGC10674
FGC10665
FGC10665
Q1b-Y2225* Panel
Q1b-Y2225* Panel
BY334
BY334
FGC10657
FGC10657
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies