Top » Catalog » SNPs » BZ113

$18.00

BZ113
[BZ113]

BZ113
hg38 Position: ChrY:17018371..17018371
Ancestral: A
Derived: G
Reference: Q Y-DNA Haplogroup project (2016)
ISOGG Haplogroup: Q1b
Comments: Below L245 > Y2209 > Y2225
Forward Primer: BZ113_F CTTATGTTAGCAAAAGCACTATGTATGTC
Reverse Primer: BZ113_R ATATACCACATTTTCCTCTTTCATTGAC
Reviews

Customers who bought this product also purchased
FGC10667
FGC10667
FGC10654
FGC10654
BZ114
BZ114
BZ3025
BZ3025
FGC10675
FGC10675
FGC10666
FGC10666
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies