Top » Catalog » SNPs » FGC10662

$18.00

FGC10662
[FGC10662]

FGC10662
hg38 Position: ChrY:12434111..12434111
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: FGC10662_F AGGCATGTGGGATTAGGAAC
Reverse Primer: FGC10662_R TTCACGTTGGAATGAAGAGAAG
Reviews

Customers who bought this product also purchased
Q1b-Y2225* Panel
Q1b-Y2225* Panel
FGC10670
FGC10670
FGC10657
FGC10657
FGC10673
FGC10673
FGC10665
FGC10665
Y2211
Y2211
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies