Top » Catalog » SNPs » FGC10662

$18.00

FGC10662
[FGC10662]

FGC10662
HG19 Position: ChrY:14545910..14545910
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments:
Forward Primer: FGC10662_F AGGCATGTGGGATTAGGAAC
Reverse Primer: FGC10662_R TTCACGTTGGAATGAAGAGAAG
Reviews

Customers who bought this product also purchased
FGC10675
FGC10675
BZ3025
BZ3025
FGC10667
FGC10667
BZ113
BZ113
FGC10653
FGC10653
FGC10674
FGC10674
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies