Top » Catalog » SNPs » FGC10662

$18.00

FGC10662
[FGC10662]

FGC10662
hg38 Position: ChrY:12434111..12434111
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: FGC10662_F AGGCATGTGGGATTAGGAAC
Reverse Primer: FGC10662_R TTCACGTTGGAATGAAGAGAAG
Reviews

Customers who bought this product also purchased
FGC10665
FGC10665
Y2211
Y2211
BY334
BY334
FGC10656
FGC10656
FGC10672
FGC10672
FGC10664
FGC10664
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies