Top » Catalog » SNPs » FGC10662

$18.00

FGC10662
[FGC10662]

FGC10662
hg38 Position: ChrY:12434111..12434111
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: FGC10662_F AGGCATGTGGGATTAGGAAC
Reverse Primer: FGC10662_R TTCACGTTGGAATGAAGAGAAG
Reviews

Customers who bought this product also purchased
FGC10654
FGC10654
BZ114
BZ114
BZ3025
BZ3025
FGC10675
FGC10675
FGC10667
FGC10667
FGC10653
FGC10653
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies