Top » Catalog » SNPs » FGC10663

$18.00

FGC10663
[FGC10663]

FGC10663
HG19 Position: ChrY:15269498..15269498
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments:
Forward Primer: FGC10663_F CAGGTGGATTACCAAACTGG
Reverse Primer: FGC10663_R TCACCCAGGCTAGTGTGAAG
Reviews

Customers who bought this product also purchased
FGC10664
FGC10664
FGC10669
FGC10669
FGC10655
FGC10655
FGC10671
FGC10671
FGC10662
FGC10662
FGC10676
FGC10676
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies