Top » Catalog » SNPs » FGC10668

$18.00

FGC10668
[FGC10668]

FGC10668
HG19 Position: ChrY:18148788..18148788
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments:
Forward Primer: FGC10668_F GGAGAAGATACTGACCTAGTCACTGG
Reverse Primer: FGC10668_R TGAAGGCTATTTGCATAATGACAAG
Reviews

Customers who bought this product also purchased
FGC10665
FGC10665
Q1b-Y2225* Panel
Q1b-Y2225* Panel
FGC10670
FGC10670
FGC10657
FGC10657
FGC10673
FGC10673
FGC10664
FGC10664
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies