Top » Catalog » SNPs » FGC10668

$18.00

FGC10668
[FGC10668]

FGC10668
hg38 Position: ChrY:16036908..16036908
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: FGC10668_F GGAGAAGATACTGACCTAGTCACTGG
Reverse Primer: FGC10668_R TGAAGGCTATTTGCATAATGACAAG
Reviews

Customers who bought this product also purchased
FGC10666
FGC10666
BZ113
BZ113
FGC10653
FGC10653
FGC10674
FGC10674
FGC10659
FGC10659
FGC10665
FGC10665
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies