Top » Catalog » SNPs » FGC10669

$18.00

FGC10669
[FGC10669]

FGC10669
hg38 Position: ChrY:16046799..16046799
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: FGC10669_F ATCTCAACCTCAAATCTCCGC
Reverse Primer: FGC10669_R CAAGGCTTTCTTCTAAGGTTTCC
Reviews

Customers who bought this product also purchased
FGC10654
FGC10654
BZ114
BZ114
BZ3025
BZ3025
FGC10675
FGC10675
FGC10666
FGC10666
FGC10653
FGC10653
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies