Top » Catalog » SNPs » FGC10669

$18.00

FGC10669
[FGC10669]

FGC10669
hg38 Position: ChrY:16046799..16046799
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: FGC10669_F ATCTCAACCTCAAATCTCCGC
Reverse Primer: FGC10669_R CAAGGCTTTCTTCTAAGGTTTCC
Reviews

Customers who bought this product also purchased
FGC10656
FGC10656
FGC10672
FGC10672
FGC10663
FGC10663
FGC10668
FGC10668
FGC10655
FGC10655
FGC10671
FGC10671
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies