Top » Catalog » SNPs » FGC10674

$18.00

FGC10674
[FGC10674]

FGC10674
hg38 Position: ChrY:20357612..20357612
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: FGC10674_F GCCATTGGTACCTCAGCATC
Reverse Primer: FGC10674_R AAACCTAAACAGGTAATGATCTTGG
Reviews

Customers who bought this product also purchased
FGC10662
FGC10662
FGC10676
FGC10676
FGC10667
FGC10667
FGC10654
FGC10654
BZ113
BZ113
BZ3025
BZ3025
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies