Top » Catalog » SNPs » FGC10674

$18.00

FGC10674
[FGC10674]

FGC10674
hg38 Position: ChrY:20357612..20357612
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: FGC10674_F GCCATTGGTACCTCAGCATC
Reverse Primer: FGC10674_R AAACCTAAACAGGTAATGATCTTGG
Reviews

Customers who bought this product also purchased
FGC10659
FGC10659
FGC10673
FGC10673
FGC10665
FGC10665
Q1b-Y2225* Panel
Q1b-Y2225* Panel
BY334
BY334
FGC10657
FGC10657
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies