Top » Catalog » SNPs » Y18604

$18.00

Y18604
[Y18604]

Y18604
hg38 Position: ChrY:14367560..14367560
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: Y18604_F TTTTATTATGCTAACCAACAAGTTTGTAG
Reverse Primer: Y18604_R GACAGGCCAACTCTGCAGAG
Reviews

Customers who bought this product also purchased
YP1237
YP1237
L53
L53
Y2197
Y2197
YP1236
YP1236
L56
L56
Y2200
Y2200
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies