Top » Catalog » SNPs » Y18604

$18.00

Y18604
[Y18604]

Y18604
hg38 Position: ChrY:14367560..14367560
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: Y18604_F TTTTATTATGCTAACCAACAAGTTTGTAG
Reverse Primer: Y18604_R GACAGGCCAACTCTGCAGAG
Reviews

Customers who bought this product also purchased
Y2220
Y2220
YP1095
YP1095
Q1b-L275 Panel
Q1b-L275 Panel
YP745
YP745
L275
L275
YP4585
YP4585
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z30120
$18.00
Haplogroup Info
Other products
Currencies