Top » Catalog » SNPs » BZ3025

$18.00

BZ3025
[BZ3025]

BZ3025
hg38 Position: ChrY:10212905..10212905
Ancestral: G
Derived: A
Reference: Alessandro Biondo (2016)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: BZ3025_F CATCACAAAAGAAGATACTCAGAAAGCT
Reverse Primer: BZ3025_R GAAATATCTTCACATAAAAACTAGACCAATG
Reviews

Customers who bought this product also purchased
BY206237
BY206237
BY251
BY251
Y63957
Y63957
A1777
A1777
Y207999
Y207999
Y133384
Y133384
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies