Top » Catalog » SNPs » BZ3025

$18.00

BZ3025
[BZ3025]

BZ3025
hg38 Position: ChrY:10212905..10212905
Ancestral: G
Derived: A
Reference: Alessandro Biondo (2016)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: BZ3025_F CATCACAAAAGAAGATACTCAGAAAGCT
Reverse Primer: BZ3025_R GAAATATCTTCACATAAAAACTAGACCAATG
Reviews

Customers who bought this product also purchased
FGC10668
FGC10668
FGC10654
FGC10654
BZ114
BZ114
FGC10662
FGC10662
FGC10675
FGC10675
FGC10667
FGC10667
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies