Top » Catalog » SNPs » BZ3025

$18.00

BZ3025
[BZ3025]

BZ3025
hg38 Position: ChrY:10212905..10212905
Ancestral: G
Derived: A
Reference: Alessandro Biondo (2016)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: BZ3025_F CATCACAAAAGAAGATACTCAGAAAGCT
Reverse Primer: BZ3025_R GAAATATCTTCACATAAAAACTAGACCAATG
Reviews

Customers who bought this product also purchased
Y23375
Y23375
FT248250
FT248250
R1b-Z2103 Panel
R1b-Z2103 Panel
Y32147
Y32147
BY206237
BY206237
BY251
BY251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies