Top » Catalog » SNPs » FGC10654

$18.00

FGC10654
[FGC10654]

FGC10654
hg38 Position: ChrY:7013341..7013341
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: Q
Comments: .
Forward Primer: FGC10654_F CCAAATAACCCCTTGCCTTTC
Reverse Primer: FGC10654_R CATAGCTTGTTGGGAATAAGAACTTG
Reviews

Customers who bought this product also purchased
FGC10655
FGC10655
BZ114
BZ114
FGC10662
FGC10662
FGC10675
FGC10675
FGC10667
FGC10667
FGC10653
FGC10653
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies