Top » Catalog » SNPs » FGC10656

$18.00

FGC10656
[FGC10656]

FGC10656
hg38 Position: ChrY:8488679..8488679
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC10656_F TTGTAGATAAAGTTTAACCAAAATGGTG
Reverse Primer: FGC10656_R ATTGACATGATTTTTACTGACAGCAG
Reviews

Customers who bought this product also purchased
BZ3025
BZ3025
FGC10674
FGC10674
FGC10666
FGC10666
Q1b-Y2225* Panel
Q1b-Y2225* Panel
FGC10670
FGC10670
FGC10659
FGC10659
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies