Top » Catalog » SNPs » FGC10656

$18.00

FGC10656
[FGC10656]

FGC10656
hg38 Position: ChrY:8488679..8488679
Ancestral: T
Derived: A
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: (not listed)
Comments: .
Forward Primer: FGC10656_F TTGTAGATAAAGTTTAACCAAAATGGTG
Reverse Primer: FGC10656_R ATTGACATGATTTTTACTGACAGCAG
Reviews

Customers who bought this product also purchased
FGC10669
FGC10669
FGC10655
FGC10655
FGC10671
FGC10671
FGC10663
FGC10663
FGC10676
FGC10676
FGC10668
FGC10668
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies