Top » Catalog » SNPs » Y20406

$18.00

Y20406
[Y20406]

Y20406
hg38 Position: ChrY:16682545..16682545
Ancestral: G
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V22 > CTS6080 > PH2818
Forward Primer: Y20406_F CGCTCATGCTATCGTTAGTAGC
Reverse Primer: Y20406_R GCCAATGTGGCTGTCTTTTC
Reviews

Customers who bought this product also purchased
BY7446
BY7446
FGC92599
FGC92599
Y133046
Y133046
Z834
Z834
FGC2739
FGC2739
Y191050
Y191050
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies