Top » Catalog » SNPs » Y4008

$18.00

Y4008
[Y4008]

Y4008
hg38 Position: ChrY:16556592..16556592
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: E1b1a1a1a2a1a3b1a9a
Comments: Below E1b-U290. Observed in I2a-L161.1 as well
Forward Primer: F2805_F GCAAAAACATGACCCTCACC
Reverse Primer: FGC4111_R CCATTCATAAGGGCTTCACC
Reviews

Customers who bought this product also purchased
U181
U181
E1b-U175 "Bantu Expansion" Panel
E1b-U175 "Bantu Expansion" Panel
Z5954
Z5954
CTS421
CTS421
Z21887
Z21887
Z1725
Z1725
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies