Top » Catalog » SNPs » Y4008

$18.00

Y4008
[Y4008]

Y4008
hg38 Position: ChrY:16556592..16556592
Ancestral: C
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: E1b1a1a1a2a1a3b1a9a
Comments: Below E1b-U290. Observed in I2a-L161.1 as well
Forward Primer: F2805_F GCAAAAACATGACCCTCACC
Reverse Primer: FGC4111_R CCATTCATAAGGGCTTCACC
Reviews

Customers who bought this product also purchased
CTS421
CTS421
Z21887
Z21887
Z1725
Z1725
Z5952
Z5952
U290
U290
Z5950
Z5950
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies