Top » Catalog » SNPs » U175

$18.00

U175
[U175]

U175
hg38 Position: ChrY:14141814..14141814
Ancestral: G
Derived: A
Reference: Sims et al. 2007
ISOGG Haplogroup: E1b1a1a1d
Comments: Below V43
Forward Primer: U175_F CAAGGATGATAAGGCAGATCATG
Reverse Primer: U175_R AGAGGTTGTAGTGGGCTGAGAC
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
CTS8294
CTS8294
M96
M96
Z1703
Z1703
Z1291
Z1291
M4437
M4437
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies