Top » Catalog » SNPs » U175

$18.00

U175
[U175]

U175
hg38 Position: ChrY:14141814..14141814
Ancestral: G
Derived: A
Reference: Sims et al. 2007
ISOGG Haplogroup: E1b1a1a1d
Comments: Below V43
Forward Primer: U175_F CAAGGATGATAAGGCAGATCATG
Reverse Primer: U175_R AGAGGTTGTAGTGGGCTGAGAC
Reviews

Customers who bought this product also purchased
CTS5961
CTS5961
CTS5788
CTS5788
M4689
M4689
CTS668
CTS668
CTS2754
CTS2754
M4670
M4670
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies