Top » Catalog » SNPs » U175

$18.00

U175
[U175]

U175
hg38 Position: ChrY:14141814..14141814
Ancestral: G
Derived: A
Reference: Sims et al. 2007
ISOGG Haplogroup: E1b1a1a1d
Comments: Below V43
Forward Primer: U175_F CAAGGATGATAAGGCAGATCATG
Reverse Primer: U175_R AGAGGTTGTAGTGGGCTGAGAC
Reviews

Customers who bought this product also purchased
FGC35964
FGC35964
CTS9387
CTS9387
CTS4625
CTS4625
Z1645
Z1645
Z22636
Z22636
CTS6454
CTS6454
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies