Top » Catalog » SNPs » Z1720

$18.00

Z1720
[Z1720]

Z1720
hg38 Position: ChrY:21459898..21459898
Ancestral: G
Derived: A
Reference: Ray Banks (2011)
ISOGG Haplogroup: E1b1a1a1d1 (not listed)
Comments: Below U175 > U209 > M4232
Forward Primer: Z1720_F GCTAAAATCATAGATACACAAATATTGCAG
Reverse Primer: Z1720_R CAGCTGTGAGAATCCAACAGTG
Reviews

Customers who bought this product also purchased
Z5954
Z5954
Z21887
Z21887
CTS421
CTS421
Z5952
Z5952
Z1725
Z1725
Z5950
Z5950
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies