Top » Catalog » SNPs » Z1720

$18.00

Z1720
[Z1720]

Z1720
hg38 Position: ChrY:21459898..21459898
Ancestral: G
Derived: A
Reference: Ray Banks (2011)
ISOGG Haplogroup: E1b1a1a1d1 (not listed)
Comments: Below U175 > U209 > M4232
Forward Primer: Z1720_F GCTAAAATCATAGATACACAAATATTGCAG
Reverse Primer: Z1720_R CAGCTGTGAGAATCCAACAGTG
Reviews

Customers who bought this product also purchased
M96
M96
CTS11248
CTS11248
CTS3119
CTS3119
M267
M267
Y65944
Y65944
V38
V38
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies