Top » Catalog » SNPs » Z1720

$18.00

Z1720
[Z1720]

Z1720
hg38 Position: ChrY:21459898..21459898
Ancestral: G
Derived: A
Reference: Ray Banks (2011)
ISOGG Haplogroup: E1b1a1a1d1 (not listed)
Comments: Below U175 > U209 > M4232
Forward Primer: Z1720_F GCTAAAATCATAGATACACAAATATTGCAG
Reverse Primer: Z1720_R CAGCTGTGAGAATCCAACAGTG
Reviews

Customers who bought this product also purchased
E Superclade Panel
E Superclade Panel
M4231
M4231
V2580
V2580
M96
M96
CTS11248
CTS11248
CTS3119
CTS3119
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies