Top » Catalog » SNPs » YSC0000076

$19.00

YSC0000076
[YSC0000076]

YSC0000076
hg38 Position: ChrY:8564050..8564050
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J1
Comments: Found in a hg J-L147 person (454 Y enrichment)
Forward Primer: YSC76_F TTTCCTGGGTCTGGCTCTAC
Reverse Primer: YSC76_R CTGGAGAAGGAGGCATTTTG
Reviews

Customers who bought this product also purchased
FT55909
FT55909
FGC22316
FGC22316
FGC50922
FGC50922
ZS4349
ZS4349
ZS1488
ZS1488
FGC2012
FGC2012
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies