Top » Catalog » SNPs » YSC0000076

$18.00

YSC0000076
[YSC0000076]

YSC0000076
hg38 Position: ChrY:8564050..8564050
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J1
Comments: Found in a hg J-L147 person (454 Y enrichment)
Forward Primer: YSC76_F TTTCCTGGGTCTGGCTCTAC
Reverse Primer: YSC76_R CTGGAGAAGGAGGCATTTTG
Reviews

Customers who bought this product also purchased
ZS6801
ZS6801
L485
L485
ZS6806
ZS6806
M215
M215
ZS1589
ZS1589
FGC7
FGC7
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies