Top » Catalog » SNPs » YSC0000076

$17.50

YSC0000076
[YSC0000076]

YSC0000076
HG19 Position: ChrY:8432091..8432091
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J1
Comments: Found in a hg J-L147 person (454 Y enrichment)
Forward Primer: YSC76_F TTTCCTGGGTCTGGCTCTAC
Reverse Primer: YSC76_R CTGGAGAAGGAGGCATTTTG
Reviews

Customers who bought this product also purchased
ZS9176
ZS9176
M267
M267
FGC3723
FGC3723
ZS4063
ZS4063
FGC5
FGC5
FGC1723
FGC1723
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies