Top » Catalog » SNPs » YSC0000076

$18.00

YSC0000076
[YSC0000076]

YSC0000076
HG19 Position: ChrY:8564050..8564050
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J1
Comments: Found in a hg J-L147 person (454 Y enrichment)
Forward Primer: YSC76_F TTTCCTGGGTCTGGCTCTAC
Reverse Primer: YSC76_R CTGGAGAAGGAGGCATTTTG
Reviews

Customers who bought this product also purchased
BY89
BY89
ZS1559
ZS1559
ZS6841
ZS6841
ZS1711
ZS1711
FGC8223
FGC8223
FGC8216
FGC8216
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies