Top » Catalog » SNPs » YSC0000076

$18.00

YSC0000076
[YSC0000076]

YSC0000076
hg38 Position: ChrY:8564050..8564050
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: J1
Comments: Found in a hg J-L147 person (454 Y enrichment)
Forward Primer: YSC76_F TTTCCTGGGTCTGGCTCTAC
Reverse Primer: YSC76_R CTGGAGAAGGAGGCATTTTG
Reviews

Customers who bought this product also purchased
YSEQ-Beta
YSEQ-Beta
Whole Genome Sequence
Whole Genome Sequence
FGC40591
FGC40591
ZS2272
ZS2272
Z18258
Z18258
ZS2259
ZS2259
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies